TICdb

release 3.3 (August 2013)
UNAV
Department of Biochemistry and Genetics




You have searched for 'ABL1'. The HGNC name for this gene is 'ABL1'.

32 record(s) found.

Interpretation



Click on an HGNC name to search for that gene.

5' PARTNER GENE3' PARTNER GENEREFERENCEFUSION SEQUENCE
BCR ABL1 17268511 aacaaggacaggggtcttcggagtCctgaactcagaagcccttcagcggccagtagc
BCR ABL1 17268511 aacaaggacaggggtcttcggagtCctgaactcaggtgatcca
BCR ABL1 AH001427 ATGATGAGTCTCCGGGGCTCTATGGGTTTCTGAATGTCATCGTCCACTCAGCCACTGGATTTAAGCAGAGTTCAAGTAAGTACTGGTTTGCCCTTTCTCTTCCAGAAGCCCTTCAGCGGCCAGTAGCATCTGACTTTGAGCCTCAGGGTCTGAGTGAAGC
BCR ABL1 AJ131466 TGACCATCAATAAGGAAGATGATGAGTCTCCGGGGCTCTATGGGTTTCTGAATGTCATCGTCCACTCAGCCACTGGATTTAAGCAGAGTTCAAAAGCCCTTCAGCGGCCAGTAGCATCTGACTTTGAGCCTCAGGGTCTGAGTGAAGCCGCTCGTTGGAACTCCAAGGAAAACCTTCTCGCTGGACCCAGTGAAAATGACCCCAACCTTT
BCR ABL1 AJ131467 CTGACATCCGTGGAGCTGCAGATGCTGACCAACTCGTGTGTGAAACTCCAGACTGTCCACAGCATTCCGCTGACCATCAATAAGGAAGAAGCCCTTCAGCGGCCAGTAGCATCTGACTTTGAGCCTCAGGGTCTGAGTGAAGCCGCTCGTTGGAACTCCAAGGAAAACCTTCTCGCTGGACCCAGTGAAAATGACCCCAACCTTTTCGTT
BCR ABL1 M25946 TCATCGTCCACTCAGCCACTGGATTTAAGCAGAGTTCAAAAGCCCTTCAGCGGCCAGTAGCATCTGACTTTGAGCCTCAGGGTCTGAGTGAAGCCGCTCGTTGGAACTCCAAGGAAAACCTTCTCGCTGGACCCAGTGAA
BCR ABL1 M31759 ACAGCAGAGCAGATTTGGCTGCTCTGTCGAGCTGGATGGATACTACTTTTTTTTTCCTTTCCCTCTAAGTGGGGGTCTCCCCCAGCTACTGGAGCTGTCAGAACAAAGAGACAGGGTCTTGCT
BCR ABL1 S72478 ATTCCGCTGACCATCAATAAGGAAGATGATGAGTCTCCGGGGCTCTATGGGTTTCTGAATGTCATCGTCCACTCAGCCACTGGATTTAAGCAGAGTTCAAGTGAAAAGCTCCGGGTCTTAGGCTATAATCACAATGGGGA
BCR ABL1 S72479 GTTGTCGTGTCCGAGGCCACCATCGTGGGCGTCCGCAAGACCGGGCAGATCTGGCCCAACGATGGCGAGGGCGCCTTCCATGGAGACGCAGGTGAAAAGCTCCGGGTCTTAGGCTATAATCACAATGGGGA
BCR ABL1 U19398 CCTCATAAACGCTGGTGTTTGGCTTGTCATAGAAGGGCATTTAAGTGACTTTGCCAAGAGAAACAGTAA
BCR ABL1 U19399 TGGGAGCTGGTGAGCTGCCCATAATGACATGATTTGGGATTACTCTTTCAGAGAA
BCR ABL1 U19400 CTAAAATTCTTTAAACCCTAAAGCGGATTTACTCTAAGGCAGTTCAGATTTGGTCCCAGCTGAGAATTATAGCCTGGAAATACCAACAGGAAAATCAGTGTCATTTGAAGGACAGTCATCTGTGCAGCCTGTGCATGAAATCATGGGTCTGAATTAGGCCCCATTCAAGATGCGGGGGTGTGGGGTTT
BCR ABL1 U19403 GATTAGCCAGGCTAGGCAGTTTTAAATCCTGGCTTTCCCCTTAACTTGGGTGGGATCACACCATTAACCGTGTTACCCCTCTGAAGCTTTGGCTCCCACACCTGTGAGATGTGAATGTTGATAACACACACCCACCTCATAGGATTAATGAGAACATGCCAAGATATAATGCGCTGAAGGTCTTAGCATGCCTGCGCAGAGCCCCAGCAT
BCR ABL1 U19404 AATTGCAGGGGTTTGGCAAGCACCTTTTCATATGTTTACTGGCCATTTGGAATATATGTGT
BCR ABL1 U19408 ACACAGTGTCCACCGGATGGATTTTATAAGTTGATCCAACCATGGTATGACTTCTGTGGGTAA
BCR ABL1 X07537 CAGATCTGGCCCAACGATGGCGAGGGCGCCTTCCATGGAGACGCAGAAGCCCTTCAGCGGCCAGTAGCATCTGACTTTGAGCCTCAGGGTCTGAGTGAAGCC
EML1 ABL1 15713800 CAGCTCTCTGTAATGCGATACTCACCAgaAGCCCTTCAGCGGCCAGTAGCATCTGAC
ETV6 ABL1 7805037 CCGGAGGTCATACTGCATCAGAACCATGAAGAAgAAGCCCTTCAGCGGCCAGTAGCATCTGACTTTGAG
ETV6 ABL1 7805037 CTTTCCAGCGGATGCTTCATGTGGTGCCAGCCATaAGACGAAAACAAGAGAAGATCCCAAAGAAAATAGAAA
ETV6 ABL1 9365838 GCCATGCCCATTGGGAGAATAGCAGaAGCCCTTCAGCGGCCAGTAGCATC
FOXP1 ABL1 21391972 acacctctcaatgcagctttacagCtctacgtctcctccgagagccgctgtggagagttacgtcgaaatgtc
INPP5D ABL1 21625237 tacagccacaagaaaaAagcccttcagcggccagtagca
NUP214 ABL1 15361874 AGGCGGCAGATGGCCAGTCAGGCACCAgAAGCCCTTCAGCGGCCAGTAGCATCTGAC
NUP214 ABL1 15361874 GGGGGCTTTGGATCCACAGCTACCTCAaAAGCCCTTCAGCGGCCAGTAGCATCTGAC
NUP214 ABL1 15361874 TCTGGGTTCAGCTTTGCCAAGCTTCAgAAGCCCTTCAGCGGCCAGTAGCATCTGAC
NUP214 ABL1 15361874 TTCTCTGGTTTTGGATCAGGCACAGGAgAAGCCCTTCAGCGGCCAGTAGCATCTGAC
NUP214 ABL1 15361874 TTTGGGTTTTCCTCTCCAAACAAAACAgAAGCCCTTCAGCGGCCAGTAGCATCTGAC
RCSD1 ABL1 19794096 gaatggtgaggagCtctacgtctcc
RCSD1 ABL1 19794096 tgcagccaaggagCtctacgtctcc
SFPQ ABL1 18205209 ggttccatgatgggaagtgacatgCtctacgtctcctccgagagccgc
SNX2 ABL1 21391972 atctttgatagatccagggaagagCtctacgtctcctccgagagccgc
ZMIZ1 ABL1 18007576 CGCCTCCTGCCCGCAGAGCACTGTATCACGAAAAaagcccttcagcggccagtagcatctgactttgagcct

Search all tables
Type in your query in the box      
(Search terms are NOT case sensitive)